prime 5.0 primer design software Search Results


97
TaKaRa taq polymerase
Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq polymerase/product/TaKaRa
Average 97 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

90
5 PRIME sephadex g-50 spin columns
Sephadex G 50 Spin Columns, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sephadex g-50 spin columns/product/5 PRIME
Average 90 stars, based on 1 article reviews
sephadex g-50 spin columns - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

99
Thermo Fisher polymerase chain reaction pcr mix
Polymerase Chain Reaction Pcr Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction pcr mix/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
polymerase chain reaction pcr mix - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

96
Revvity ivis spectrum
Ivis Spectrum, supplied by Revvity, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ivis spectrum/product/Revvity
Average 96 stars, based on 1 article reviews
ivis spectrum - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
Ivoclar Vivadent US monobond plus ceramic primer
Monobond Plus Ceramic Primer, supplied by Ivoclar Vivadent US, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monobond plus ceramic primer/product/Ivoclar Vivadent US
Average 90 stars, based on 1 article reviews
monobond plus ceramic primer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

99
Thermo Fisher primer
Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

90
Federation of European Neuroscience Societies primer dsr-r
Primer Dsr R, supplied by Federation of European Neuroscience Societies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer dsr-r/product/Federation of European Neuroscience Societies
Average 90 stars, based on 1 article reviews
primer dsr-r - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

98
TaKaRa primers 50 tcggcttggttggccaggtggtctct 30
Primers 50 Tcggcttggttggccaggtggtctct 30, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers 50 tcggcttggttggccaggtggtctct 30/product/TaKaRa
Average 98 stars, based on 1 article reviews
primers 50 tcggcttggttggccaggtggtctct 30 - by Bioz Stars, 2026-05
98/100 stars
  Buy from Supplier

99
Thermo Fisher amplitaq gold dna polymerase
Amplitaq Gold Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amplitaq gold dna polymerase/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
amplitaq gold dna polymerase - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

99
TaKaRa reaction mixture
Reaction Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reaction mixture/product/TaKaRa
Average 99 stars, based on 1 article reviews
reaction mixture - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

90
Molecular Biosciences Inc forward primer 50-cctaaagcttctaatacgactcac tatagggag ccagcaccacaatcaa-30
Forward Primer 50 Cctaaagcttctaatacgactcac Tatagggag Ccagcaccacaatcaa 30, supplied by Molecular Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 50-cctaaagcttctaatacgactcac tatagggag ccagcaccacaatcaa-30/product/Molecular Biosciences Inc
Average 90 stars, based on 1 article reviews
forward primer 50-cctaaagcttctaatacgactcac tatagggag ccagcaccacaatcaa-30 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

98
TaKaRa ex taq polymerase
Ex Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ex taq polymerase/product/TaKaRa
Average 98 stars, based on 1 article reviews
ex taq polymerase - by Bioz Stars, 2026-05
98/100 stars
  Buy from Supplier

Image Search Results